Skip Menu |
 

This queue is for tickets about the Bio-SamTools CPAN distribution.

Report information
The Basics
Id: 101735
Status: open
Priority: 0/
Queue: Bio-SamTools

People
Owner: Nobody in particular
Requestors: shokin [...] carnegiescience.edu
Cc:
AdminCc:

Bug Information
Severity: (no value)
Broken in: (no value)
Fixed in: (no value)



Subject: Bio::DB:Sam won't read a particular BAM file
Date: Sun, 25 Jan 2015 14:04:59 -0600
To: bug-Bio-SamTools [...] rt.cpan.org
From: Sam Hokin <shokin [...] carnegiescience.edu>
Download (untitled) / with headers
text/plain 10.1k
This is a totally unrelated issue from the one I posted earlier today. I want to view NGS reads stored in a BAM file created by bwa within the pecnv pipeline. For some reason, GBrowse refuses to recognize this DB, although it works fine with BAM files generated by Tophat. Here's the config, the top works, the bottom one errors: # Tophat-generated BAM, works [Fowler.Seedling:database] db_adaptor = Bio::DB::Sam db_args = -fasta /mnt/data/AGPv3/AGPv3.fa -bam /mnt/data/MGP/Fowler_Lab/Build_v3_AllDataOutput/Seedling/accepted_hits-merged-reheader.bam search options = default # BWA-generated BAM, does not work [Fowler.FC216.s_2.pecnv:database] db_adapter = Bio::DB::Sam db_args = -fasta /mnt/data/AGPv3/AGPv3.fa -bam /mnt/data/MGP/Fowler_Lab/MGP_1st_RawRNAseqData/FC216/pecnv_output/pecnv_bamfile_sorted.bam search options = default Here's the server error message stream (fairly redundant, this is from a single page refresh): [Sun Jan 25 14:01:45.872291 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.872331 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.872335 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataBase.pm line 44., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.872337 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser, referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.979673 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: 2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.979718 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.979723 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataBase.pm line 44., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:46.727828 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:46.727919 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:46.727939 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:46.727943 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Brow, referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:46.893947 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: ser2/DataBase.pm line 44., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.041979 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.042026 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.042030 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.042033 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Brow, referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.104902 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: ser2/DataBase.pm line 44., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database And here's the top several lines of the BAM file in question. It looks fine to me. I've checked file permissions all the way down. sam@biogrinder:~/Fowler_Lab/MGP_1st_RawRNAseqData/FC216> samtools view pecnv_output/pecnv_bamfile_sorted.bam | head ILLUMINA-20A1B2_0007_FC6286NAAXX:2:47:2604:12848#0 163 1 204 60 80M = 454 330 GCATTGAACAAGACTATGTTAGTAGGATGTTGTTGAAGTATCCATGGATTCTTTCAACGAGTGTGATAGAGAACTACAGT GIIIIIIIIHIIIIIIIIIIGIIIIIIHIHFIHIIIIIEIHIIIIIIHHHIHIHIIHIDCECIDEHFHBFHDIIIFHEHB XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:47:2604:12848#0 83 1 454 60 80M = 204 -330 AAGTTGGCCTCATATTCTTGGCTCCTCTTCAAAAAGAATGAATTCAGTTTTGGAGCTGTTTCATGTTCTGGGCATCAGTA IEHGGHHDGGGHHGHDIEGIHHHHHIIIIHIIIIIIIIIIGIGIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:51:14470:18409#0 99 1 2265 60 80M = 2411 226 AGATATTAAAGGAGGACTGTCCATGATTGGTCTGTTCGAAATTTTCAGCTATGGGACACCACACATGGAGTTTCTTTAAC IIIIIIIIIIIIIIIIIIIIIIIHHIIIIIHHIIIIIIGIIIIIIIIIIIIHIIIGIIHIIIIIHHIIGIDEGGGEHFII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:51:14470:18409#0 147 1 2411 60 80M = 2265 -226 CAGAGTCTTCTTCCATGGTTTGGTCTCCTTTGATCCTTGGAAGCGTATTTGGAAAACTTGGACTCCACCTAATTGCAAGA Show quoted text
HE>HEGHHEHHGIHGHIHH@IIHGHIHGIIIIEIHIIIIIIHIIIIIIIIHIIIIIIIIIIHIIIGEGGGIIIIIIGIII
XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:84:8055:2888#0 163 1 2505 60 80M = 2628 203 CCTGTCCGAAATCGCTGTTGGACTGCGGACCGATTGGCTCGGAGAGGACTGGCACACCTAGTCCCTTGAATTCATTGCGC HIIIIIIIIGIIIHIIHIHHIIHGIDIHGIIIIFHDGGDG8???:?A;<=:<;5:;??;-=<:?25:2//2529.@;8@# XT:A:U NM:i:3 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:64A8T5A0 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:24:19049:7269#0 99 1 2512 29 65M15S = 2639 207 GAAATCGCTGTTGGACTGCGGACCGATTGGCTCCGGGAGGACCGGCCCCCCCAGTCCATTTAATTTTTTTCGGCCCGGGA IIIIIIIIIIIIIIHIIIIHIIIIIIHIIHGDG+D############################################# XT:A:M NM:i:7 SM:i:29 AM:i:29 XM:i:7 XO:i:0 XG:i:0 MD:Z:33G1A6T3A1A2T8G4 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:117:18892:9016#0 99 1 2617 60 80M = 2734 197 TTTCCTATGTTTTCTTGAGGGAATTCTGGTTTAGAGTTTTCTCCTGGCTGGTGTATGTTGACCGTGTGCCGGGGTCCCAG Show quoted text
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIHGIHFGGEGDDEEGCEEIDIFFIIBCEG>E
XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:84:8055:2888#0 83 1 2628 60 80M = 2505 -203 TTCTTGAGGGAATTCTGGTTTAGAGTTTTCTCCTGGCTGGTGTATGTTGACCGTGTGCCGGGGTCCCAGGAGCAATCGCT C@@B<EDEEEEDGGEIGEGGGGGEEFGGEGEIGIIIGGIIHHGHIGIIIDIIIIIIIHHIIIIIIIIIIIIIHIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:24:19049:7269#0 147 1 2639 29 80M = 2512 -207 ATTCTGGTTTAGAGTTTTCTCCTGGCTGGTGTATGTTGACCGTGTGCCGGGGTCCCAGGAGCAATCGCTTGCAGATTGGT DCF<GCBD>DEBEIFFBFIEIH<IIIIGHGIDHIHEHIEIIIIIIIBFIIIIIIIDIHHIIIHIIIIHIIIIIIIIHIIH XT:A:U NM:i:0 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:10:19776:18833#0 99 1 2660 60 80M = 2826 246 CTGGCTGGTGTATGTTGACCGTGTGCCGGGGTCCCAGGAGCAATCGCTTGCAGATTGGTGGTGAAAGGCTTGCAAACATC Show quoted text
IIIIIIIIIBFIIGIIIIIIIIHGIEIIDIIDIIIGGFFFHFHEIIIGDIHCH>EHDIBFG=E@CBBB<?@?6;A#####
XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 sam@biogrinder:~/Fowler_Lab/MGP_1st_RawRNAseqData/FC216>
From: dan.bolser [...] gmail.com
Are both BAM files definitely sorted and indexed (with the same naming convention for the index)?
Subject: Re: [rt.cpan.org #101735] Bio::DB:Sam won't read a particular BAM file
Date: Thu, 20 Aug 2015 07:53:40 -0500
To: bug-Bio-SamTools [...] rt.cpan.org
From: Sam Hokin <shokin [...] carnegiescience.edu>
Download (untitled) / with headers
text/plain 312b
Whoa, this is an old one. I think I wound up munging the files so they'd work. :) Thanks, though! On 08/20/2015 07:26 AM, Dan Bolser via RT wrote: Show quoted text
> <URL: https://rt.cpan.org/Ticket/Display.html?id=101735 > > > Are both BAM files definitely sorted and indexed (with the same naming convention for the index)? >


This service is sponsored and maintained by Best Practical Solutions and runs on Perl.org infrastructure.

Please report any issues with rt.cpan.org to rt-cpan-admin@bestpractical.com.