This queue is for tickets about the Bio-SamTools CPAN distribution.

Report information
The Basics

Nobody in particular
shokin [...]

(no value)
Broken in:
(no value)
Fixed in:
(no value)

Subject: Bio::DB:Sam won't read a particular BAM file
Date: Sun, 25 Jan 2015 14:04:59 -0600
From: Sam Hokin <>
This is a totally unrelated issue from the one I posted earlier today. I want to view NGS reads stored in a BAM file created by bwa within the pecnv pipeline. For some reason, GBrowse refuses to recognize this DB, although it works fine with BAM files generated by Tophat. Here's the config, the top works, the bottom one errors: # Tophat-generated BAM, works [Fowler.Seedling:database] db_adaptor = Bio::DB::Sam db_args = -fasta /mnt/data/AGPv3/AGPv3.fa -bam /mnt/data/MGP/Fowler_Lab/Build_v3_AllDataOutput/Seedling/accepted_hits-merged-reheader.bam search options = default # BWA-generated BAM, does not work [Fowler.FC216.s_2.pecnv:database] db_adapter = Bio::DB::Sam db_args = -fasta /mnt/data/AGPv3/AGPv3.fa -bam /mnt/data/MGP/Fowler_Lab/MGP_1st_RawRNAseqData/FC216/pecnv_output/pecnv_bamfile_sorted.bam search options = default Here's the server error message stream (fairly redundant, this is from a single page refresh): [Sun Jan 25 14:01:45.872291 2015] [fcgid:warn] [pid 27908] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer: [Sun Jan 25 14:01:45.872331 2015] [fcgid:warn] [pid 27908] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer: [Sun Jan 25 14:01:45.872335 2015] [fcgid:warn] [pid 27908] [client] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 44., referer: [Sun Jan 25 14:01:45.872337 2015] [fcgid:warn] [pid 27908] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser, referer: [Sun Jan 25 14:01:45.979673 2015] [fcgid:warn] [pid 27908] [client] mod_fcgid: stderr: 2/ line 943., referer: [Sun Jan 25 14:01:45.979718 2015] [fcgid:warn] [pid 27908] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer: [Sun Jan 25 14:01:45.979723 2015] [fcgid:warn] [pid 27908] [client] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 44., referer: [Sun Jan 25 14:01:46.727828 2015] [fcgid:warn] [pid 27920] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer:;dbid=annotations:database [Sun Jan 25 14:01:46.727919 2015] [fcgid:warn] [pid 27920] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer:;dbid=annotations:database [Sun Jan 25 14:01:46.727939 2015] [fcgid:warn] [pid 27920] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer:;dbid=annotations:database [Sun Jan 25 14:01:46.727943 2015] [fcgid:warn] [pid 27920] [client] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Brow, referer:;dbid=annotations:database [Sun Jan 25 14:01:46.893947 2015] [fcgid:warn] [pid 27920] [client] mod_fcgid: stderr: ser2/ line 44., referer:;dbid=annotations:database [Sun Jan 25 14:01:48.041979 2015] [fcgid:warn] [pid 27956] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer:;dbid=annotations:database [Sun Jan 25 14:01:48.042026 2015] [fcgid:warn] [pid 27956] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer:;dbid=annotations:database [Sun Jan 25 14:01:48.042030 2015] [fcgid:warn] [pid 27956] [client] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/ line 943., referer:;dbid=annotations:database [Sun Jan 25 14:01:48.042033 2015] [fcgid:warn] [pid 27956] [client] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Brow, referer:;dbid=annotations:database [Sun Jan 25 14:01:48.104902 2015] [fcgid:warn] [pid 27956] [client] mod_fcgid: stderr: ser2/ line 44., referer:;dbid=annotations:database And here's the top several lines of the BAM file in question. It looks fine to me. I've checked file permissions all the way down. sam@biogrinder:~/Fowler_Lab/MGP_1st_RawRNAseqData/FC216> samtools view pecnv_output/pecnv_bamfile_sorted.bam | head ILLUMINA-20A1B2_0007_FC6286NAAXX:2:47:2604:12848#0 163 1 204 60 80M = 454 330 GCATTGAACAAGACTATGTTAGTAGGATGTTGTTGAAGTATCCATGGATTCTTTCAACGAGTGTGATAGAGAACTACAGT GIIIIIIIIHIIIIIIIIIIGIIIIIIHIHFIHIIIIIEIHIIIIIIHHHIHIHIIHIDCECIDEHFHBFHDIIIFHEHB XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:47:2604:12848#0 83 1 454 60 80M = 204 -330 AAGTTGGCCTCATATTCTTGGCTCCTCTTCAAAAAGAATGAATTCAGTTTTGGAGCTGTTTCATGTTCTGGGCATCAGTA IEHGGHHDGGGHHGHDIEGIHHHHHIIIIHIIIIIIIIIIGIGIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:51:14470:18409#0 99 1 2265 60 80M = 2411 226 AGATATTAAAGGAGGACTGTCCATGATTGGTCTGTTCGAAATTTTCAGCTATGGGACACCACACATGGAGTTTCTTTAAC IIIIIIIIIIIIIIIIIIIIIIIHHIIIIIHHIIIIIIGIIIIIIIIIIIIHIIIGIIHIIIIIHHIIGIDEGGGEHFII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:51:14470:18409#0 147 1 2411 60 80M = 2265 -226 CAGAGTCTTCTTCCATGGTTTGGTCTCCTTTGATCCTTGGAAGCGTATTTGGAAAACTTGGACTCCACCTAATTGCAAGA
Show quoted text
Show quoted text
Show quoted text
XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 sam@biogrinder:~/Fowler_Lab/MGP_1st_RawRNAseqData/FC216>
Are both BAM files definitely sorted and indexed (with the same naming convention for the index)?
Subject: Re: [ #101735] Bio::DB:Sam won't read a particular BAM file
Date: Thu, 20 Aug 2015 07:53:40 -0500
From: Sam Hokin <>
Whoa, this is an old one. I think I wound up munging the files so they'd work. :) Thanks, though! On 08/20/2015 07:26 AM, Dan Bolser via RT wrote:
Show quoted text
> <URL: > > > Are both BAM files definitely sorted and indexed (with the same naming convention for the index)? >

This service runs on Request Tracker, is sponsored by The Perl Foundation, and maintained by Best Practical Solutions.

Please report any issues with to