This queue is for tickets about the Bio-SamTools CPAN distribution.

Report information
The Basics
Id:
101735
Status:
open
Priority:
Low/Low
Queue:

People
Owner:
Nobody in particular
Requestors:
shokin [...] carnegiescience.edu
Cc:
AdminCc:

BugTracker
Severity:
(no value)
Broken in:
(no value)
Fixed in:
(no value)



MIME-Version: 1.0
X-Spam-Status: No, score=-0.001 tagged_above=-99.9 required=10 tests=[BAYES_00=-1.9, DKIM_SIGNED=0.1, DKIM_VALID=-0.1, DKIM_VALID_AU=-0.1, DNS_FROM_AHBL_RHSBL=2.699, RCVD_IN_DNSWL_LOW=-0.7] autolearn=no
X-Spam-Flag: NO
X-Virus-Checked: Checked
content-type: text/plain; charset="utf-8"; format="flowed"
Message-ID: <54C54C6B.4000709@carnegiescience.edu>
X-Received: by 10.50.164.227 with SMTP id yt3mr12938592igb.32.1422216300552; Sun, 25 Jan 2015 12:05:00 -0800 (PST)
X-Virus-Scanned: Debian amavisd-new at bestpractical.com
X-Spam-Score: -0.001
Received: from localhost (localhost [127.0.0.1]) by hipster.bestpractical.com (Postfix) with ESMTP id D7F652406EF for <cpan-bug+Bio-SamTools@hipster.bestpractical.com>; Sun, 25 Jan 2015 15:05:14 -0500 (EST)
Received: from hipster.bestpractical.com ([127.0.0.1]) by localhost (hipster.bestpractical.com [127.0.0.1]) (amavisd-new, port 10024) with ESMTP id llg872siVE2R for <cpan-bug+Bio-SamTools@hipster.bestpractical.com>; Sun, 25 Jan 2015 15:05:10 -0500 (EST)
Received: from la.mx.develooper.com (x1.develooper.com [207.171.7.70]) by hipster.bestpractical.com (Postfix) with SMTP id 0AF5A240271 for <bug-Bio-SamTools@rt.cpan.org>; Sun, 25 Jan 2015 15:05:09 -0500 (EST)
Received: (qmail 11054 invoked by alias); 25 Jan 2015 20:05:09 -0000
Received: from mail-ig0-f181.google.com (HELO mail-ig0-f181.google.com) (209.85.213.181) by la.mx.develooper.com (qpsmtpd/0.28) with ESMTP; Sun, 25 Jan 2015 12:05:04 -0800
Received: by mail-ig0-f181.google.com with SMTP id hn18so5273786igb.2 for <bug-Bio-SamTools@rt.cpan.org>; Sun, 25 Jan 2015 12:05:00 -0800 (PST)
Received: from [192.168.1.82] (99-126-180-113.lightspeed.mdsnwi.sbcglobal.net. [99.126.180.113]) by mx.google.com with ESMTPSA id b64sm4747873iob.42.2015.01.25.12.04.58 for <bug-Bio-SamTools@rt.cpan.org> (version=TLSv1.2 cipher=ECDHE-RSA-AES128-GCM-SHA256 bits=128/128); Sun, 25 Jan 2015 12:04:59 -0800 (PST)
Authentication-Results: hipster.bestpractical.com (amavisd-new); dkim=pass header.i=@carnegiescience.edu
Delivered-To: cpan-bug+Bio-SamTools@hipster.bestpractical.com
Subject: Bio::DB:Sam won't read a particular BAM file
User-Agent: Mozilla/5.0 (Windows NT 6.3; WOW64; rv:31.0) Gecko/20100101 Thunderbird/31.4.0
Return-Path: <shokin@carnegiescience.edu>
X-RT-Mail-Extension: bio-samtools
X-Original-To: cpan-bug+Bio-SamTools@hipster.bestpractical.com
X-Spam-Check-BY: la.mx.develooper.com
Dkim-Signature: v=1; a=rsa-sha256; c=relaxed/relaxed; d=carnegiescience.edu; s=google; h=message-id:date:from:user-agent:mime-version:to:subject :content-type:content-transfer-encoding; bh=tohSqUc862SLnOq/vELKTR2/v21TzH15B4DgxzjKEUk=; b=pnWeZ9lmPb+Ll5ql0rsyaUl896fxH/kh60Lz1QZlBa6/gQQ0uvxAOf531OARLa5V+Z dlUgGv7OTu8dmST4SbCy70orP0pKF6FGl/yQiVRm1nyMRJUJxu8boLWsnxOR4bwaC/Ld NWt534k+t8cMBu0FO2lpidFgzp2KrWqTiT0O0=
X-Google-Dkim-Signature: v=1; a=rsa-sha256; c=relaxed/relaxed; d=1e100.net; s=20130820; h=x-gm-message-state:message-id:date:from:user-agent:mime-version:to :subject:content-type:content-transfer-encoding; bh=tohSqUc862SLnOq/vELKTR2/v21TzH15B4DgxzjKEUk=; b=Tuiy/FuSJXz+/kC9QwTixK7bFdiMcrvhWRZQGQ0sPAgmR9kN8LhgDBsUMdx2RsBISR ueWgR3iohk2ubguJoXUNTTQF6nbgHgo8wUxG9Psvlyjj/KYbu1DW+55rNKSMiFJAOLs/ XaUIFF6Oy6HWJF5iruy+DkxGjBP4vx34s3ln6pPBXYgdL+BeAxdS4IB4OkqOIB6enuuW 0/LwYp7ZNQQGbAacm6eqmP472u5qaXpjNF43sx1m0qmuEexkFSdWxh37Ol8L1mTiKX7l g/ZhLcdhm8EnOQXka0XXqaBhBk+HNcBZ4eqD8OMy3dg2yeBtQQTToxHYfprnKWGc0FqH r16g==
Date: Sun, 25 Jan 2015 14:04:59 -0600
X-Spam-Level:
To: bug-Bio-SamTools@rt.cpan.org
Content-Transfer-Encoding: 7bit
From: Sam Hokin <shokin@carnegiescience.edu>
X-GM-Message-State: ALoCoQmmrzRH9uJ9Xw5XFFpNE+Wh3JCs/J4mF9bQR0HAqrgtoexrL7QPK7vdXllxQw6v0yMGMB6P0/iUqCq6M06iTVECqhQb1dE8a9y2LzY2h5GnH/M4QQICM1yJldWjzUsaO7+R5AI7RqCPm88sdMQwqRD2kaf1vpUMRd+ex7EuFnh2MPmHmWTtuG+XTxnKIPwL/7amRw6j
X-RT-Original-Encoding: utf-8
X-RT-Interface: Email
Content-Length: 10434
This is a totally unrelated issue from the one I posted earlier today. I want to view NGS reads stored in a BAM file created by bwa within the pecnv pipeline. For some reason, GBrowse refuses to recognize this DB, although it works fine with BAM files generated by Tophat. Here's the config, the top works, the bottom one errors: # Tophat-generated BAM, works [Fowler.Seedling:database] db_adaptor = Bio::DB::Sam db_args = -fasta /mnt/data/AGPv3/AGPv3.fa -bam /mnt/data/MGP/Fowler_Lab/Build_v3_AllDataOutput/Seedling/accepted_hits-merged-reheader.bam search options = default # BWA-generated BAM, does not work [Fowler.FC216.s_2.pecnv:database] db_adapter = Bio::DB::Sam db_args = -fasta /mnt/data/AGPv3/AGPv3.fa -bam /mnt/data/MGP/Fowler_Lab/MGP_1st_RawRNAseqData/FC216/pecnv_output/pecnv_bamfile_sorted.bam search options = default Here's the server error message stream (fairly redundant, this is from a single page refresh): [Sun Jan 25 14:01:45.872291 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.872331 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.872335 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataBase.pm line 44., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.872337 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser, referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.979673 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: 2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.979718 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:45.979723 2015] [fcgid:warn] [pid 27908] [client 99.126.180.113:51551] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataBase.pm line 44., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=DTA_ZM00033 [Sun Jan 25 14:01:46.727828 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:46.727919 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:46.727939 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:46.727943 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Brow, referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:46.893947 2015] [fcgid:warn] [pid 27920] [client 99.126.180.113:51555] mod_fcgid: stderr: ser2/DataBase.pm line 44., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.041979 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.042026 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.042030 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: Unknown database defined for Fowler.FC216.s_2.pecnv.Reads at /usr/local/lib64/perl5/Bio/Graphics/Browser2/DataSource.pm line 943., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.042033 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: Could not open database: Can't call method "new" on an undefined value at /usr/local/lib64/perl5/Bio/Graphics/Brow, referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database [Sun Jan 25 14:01:48.104902 2015] [fcgid:warn] [pid 27956] [client 99.126.180.113:51554] mod_fcgid: stderr: ser2/DataBase.pm line 44., referer: http://bartontools.dpb.carnegiescience.edu/fgb2/gbrowse/AGPv3/?name=id:977988;dbid=annotations:database And here's the top several lines of the BAM file in question. It looks fine to me. I've checked file permissions all the way down. sam@biogrinder:~/Fowler_Lab/MGP_1st_RawRNAseqData/FC216> samtools view pecnv_output/pecnv_bamfile_sorted.bam | head ILLUMINA-20A1B2_0007_FC6286NAAXX:2:47:2604:12848#0 163 1 204 60 80M = 454 330 GCATTGAACAAGACTATGTTAGTAGGATGTTGTTGAAGTATCCATGGATTCTTTCAACGAGTGTGATAGAGAACTACAGT GIIIIIIIIHIIIIIIIIIIGIIIIIIHIHFIHIIIIIEIHIIIIIIHHHIHIHIIHIDCECIDEHFHBFHDIIIFHEHB XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:47:2604:12848#0 83 1 454 60 80M = 204 -330 AAGTTGGCCTCATATTCTTGGCTCCTCTTCAAAAAGAATGAATTCAGTTTTGGAGCTGTTTCATGTTCTGGGCATCAGTA IEHGGHHDGGGHHGHDIEGIHHHHHIIIIHIIIIIIIIIIGIGIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:51:14470:18409#0 99 1 2265 60 80M = 2411 226 AGATATTAAAGGAGGACTGTCCATGATTGGTCTGTTCGAAATTTTCAGCTATGGGACACCACACATGGAGTTTCTTTAAC IIIIIIIIIIIIIIIIIIIIIIIHHIIIIIHHIIIIIIGIIIIIIIIIIIIHIIIGIIHIIIIIHHIIGIDEGGGEHFII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:51:14470:18409#0 147 1 2411 60 80M = 2265 -226 CAGAGTCTTCTTCCATGGTTTGGTCTCCTTTGATCCTTGGAAGCGTATTTGGAAAACTTGGACTCCACCTAATTGCAAGA
Show quoted text
HE>HEGHHEHHGIHGHIHH@IIHGHIHGIIIIEIHIIIIIIHIIIIIIIIHIIIIIIIIIIHIIIGEGGGIIIIIIGIII
XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:84:8055:2888#0 163 1 2505 60 80M = 2628 203 CCTGTCCGAAATCGCTGTTGGACTGCGGACCGATTGGCTCGGAGAGGACTGGCACACCTAGTCCCTTGAATTCATTGCGC HIIIIIIIIGIIIHIIHIHHIIHGIDIHGIIIIFHDGGDG8???:?A;<=:<;5:;??;-=<:?25:2//2529.@;8@# XT:A:U NM:i:3 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:64A8T5A0 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:24:19049:7269#0 99 1 2512 29 65M15S = 2639 207 GAAATCGCTGTTGGACTGCGGACCGATTGGCTCCGGGAGGACCGGCCCCCCCAGTCCATTTAATTTTTTTCGGCCCGGGA IIIIIIIIIIIIIIHIIIIHIIIIIIHIIHGDG+D############################################# XT:A:M NM:i:7 SM:i:29 AM:i:29 XM:i:7 XO:i:0 XG:i:0 MD:Z:33G1A6T3A1A2T8G4 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:117:18892:9016#0 99 1 2617 60 80M = 2734 197 TTTCCTATGTTTTCTTGAGGGAATTCTGGTTTAGAGTTTTCTCCTGGCTGGTGTATGTTGACCGTGTGCCGGGGTCCCAG
Show quoted text
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIHGIHFGGEGDDEEGCEEIDIFFIIBCEG>E
XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:84:8055:2888#0 83 1 2628 60 80M = 2505 -203 TTCTTGAGGGAATTCTGGTTTAGAGTTTTCTCCTGGCTGGTGTATGTTGACCGTGTGCCGGGGTCCCAGGAGCAATCGCT C@@B<EDEEEEDGGEIGEGGGGGEEFGGEGEIGIIIGGIIHHGHIGIIIDIIIIIIIHHIIIIIIIIIIIIIHIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:24:19049:7269#0 147 1 2639 29 80M = 2512 -207 ATTCTGGTTTAGAGTTTTCTCCTGGCTGGTGTATGTTGACCGTGTGCCGGGGTCCCAGGAGCAATCGCTTGCAGATTGGT DCF<GCBD>DEBEIFFBFIEIH<IIIIGHGIDHIHEHIEIIIIIIIBFIIIIIIIDIHHIIIHIIIIHIIIIIIIIHIIH XT:A:U NM:i:0 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 ILLUMINA-20A1B2_0007_FC6286NAAXX:2:10:19776:18833#0 99 1 2660 60 80M = 2826 246 CTGGCTGGTGTATGTTGACCGTGTGCCGGGGTCCCAGGAGCAATCGCTTGCAGATTGGTGGTGAAAGGCTTGCAAACATC
Show quoted text
IIIIIIIIIBFIIGIIIIIIIIHGIEIIDIIDIIIGGFFFHFHEIIIGDIHCH>EHDIBFG=E@CBBB<?@?6;A#####
XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:80 sam@biogrinder:~/Fowler_Lab/MGP_1st_RawRNAseqData/FC216>
MIME-Version: 1.0
In-Reply-To: <54C54C6B.4000709@carnegiescience.edu>
X-Mailer: MIME-tools 5.504 (Entity 5.504)
Content-Disposition: inline
X-RT-Interface: API
References: <54C54C6B.4000709@carnegiescience.edu>
Content-Type: text/plain; charset="utf-8"
Message-ID: <rt-4.0.18-26344-1440073569-1468.0-0-0@rt.cpan.org>
Message-ID: <rt-4.0.18-26344-1440073569-603.101735-0-0@rt.cpan.org>
Content-Transfer-Encoding: binary
X-RT-Original-Encoding: utf-8
From: dan.bolser@gmail.com
Content-Length: 97
Are both BAM files definitely sorted and indexed (with the same naming convention for the index)?
MIME-Version: 1.0
X-Spam-Status: No, score=-4.525 tagged_above=-99.9 required=10 tests=[AWL=2.175, BAYES_00=-1.9, DKIM_SIGNED=0.1, DKIM_VALID=-0.1, DKIM_VALID_AU=-0.1, FROM_OUR_RT=-4, RCVD_IN_DNSWL_LOW=-0.7] autolearn=ham
In-Reply-To: <rt-4.0.18-26344-1440073570-846.101735-6-0@rt.cpan.org>
X-Spam-Flag: NO
X-RT-Interface: API
References: <RT-Ticket-101735@rt.cpan.org> <54C54C6B.4000709@carnegiescience.edu> <rt-4.0.18-26344-1440073570-846.101735-6-0@rt.cpan.org>
X-Virus-Scanned: Debian amavisd-new at bestpractical.com
X-Received: by 10.170.174.65 with SMTP id q62mr2865999ykd.63.1440075224353; Thu, 20 Aug 2015 05:53:44 -0700 (PDT)
Message-ID: <55D5CDD4.5020505@carnegiescience.edu>
content-type: text/plain; charset="utf-8"; format="flowed"
X-RT-Original-Encoding: utf-8
X-Spam-Score: -4.525
Authentication-Results: hipster.bestpractical.com (amavisd-new); dkim=pass header.i=@carnegiescience.edu
Received: from localhost (localhost [127.0.0.1]) by hipster.bestpractical.com (Postfix) with ESMTP id 07E39240334 for <cpan-bug+Bio-SamTools@hipster.bestpractical.com>; Thu, 20 Aug 2015 08:53:53 -0400 (EDT)
Received: from hipster.bestpractical.com ([127.0.0.1]) by localhost (hipster.bestpractical.com [127.0.0.1]) (amavisd-new, port 10024) with ESMTP id 9QfFGdRDAcf1 for <cpan-bug+Bio-SamTools@hipster.bestpractical.com>; Thu, 20 Aug 2015 08:53:51 -0400 (EDT)
Received: from la.mx.develooper.com (x1.develooper.com [207.171.7.70]) by hipster.bestpractical.com (Postfix) with SMTP id 8014B2402E6 for <bug-Bio-SamTools@rt.cpan.org>; Thu, 20 Aug 2015 08:53:51 -0400 (EDT)
Received: (qmail 27028 invoked by alias); 20 Aug 2015 12:53:50 -0000
Received: from mail-yk0-f177.google.com (HELO mail-yk0-f177.google.com) (209.85.160.177) by la.mx.develooper.com (qpsmtpd/0.28) with ESMTP; Thu, 20 Aug 2015 05:53:48 -0700
Received: by ykdt205 with SMTP id t205so36210527ykd.1 for <bug-Bio-SamTools@rt.cpan.org>; Thu, 20 Aug 2015 05:53:44 -0700 (PDT)
Received: from [192.168.1.99] (99-126-180-113.lightspeed.mdsnwi.sbcglobal.net. [99.126.180.113]) by smtp.googlemail.com with ESMTPSA id x8sm3843246ywa.41.2015.08.20.05.53.42 for <bug-Bio-SamTools@rt.cpan.org> (version=TLSv1.2 cipher=ECDHE-RSA-AES128-GCM-SHA256 bits=128/128); Thu, 20 Aug 2015 05:53:42 -0700 (PDT)
Delivered-To: cpan-bug+Bio-SamTools@hipster.bestpractical.com
User-Agent: Mozilla/5.0 (X11; Linux x86_64; rv:31.0) Gecko/20100101 Thunderbird/31.8.0
Subject: Re: [rt.cpan.org #101735] Bio::DB:Sam won't read a particular BAM file
Return-Path: <shokin@carnegiescience.edu>
Dkim-Signature: v=1; a=rsa-sha256; c=relaxed/relaxed; d=carnegiescience.edu; s=google; h=message-id:date:from:user-agent:mime-version:to:subject:references :in-reply-to:content-type:content-transfer-encoding; bh=jfmWfTVmxhIJHdwUHWhpi+Bwla5j16N8r1UGXSOmuW8=; b=nKGLPE8LJeOrk7uekuJIuQtXma0g/BYHUv3uIhFudbfFwkcu3Ffr/LXiE3nFzjn1zx ys0ojsvX6K0U33N+zdenziuQK42/B/Ejqk/Wwp13e2xWdPZL93TWSqTEbcJ95uzzTYYa KD7cui4QQeSZiLGQ+kNR4loiSVhZwCOew3Elw=
X-Spam-Check-BY: la.mx.develooper.com
X-Original-To: cpan-bug+Bio-SamTools@hipster.bestpractical.com
X-RT-Mail-Extension: bio-samtools
X-Google-Dkim-Signature: v=1; a=rsa-sha256; c=relaxed/relaxed; d=1e100.net; s=20130820; h=x-gm-message-state:message-id:date:from:user-agent:mime-version:to :subject:references:in-reply-to:content-type :content-transfer-encoding; bh=jfmWfTVmxhIJHdwUHWhpi+Bwla5j16N8r1UGXSOmuW8=; b=e7zAFqaeLKICT0gF88z+f2g6HHSm3ZQyYDHXpRd3a3Pd5oOUJBspUKwv4kZuDhZV/P qYlKTioMiSrKSTF37UbHSqc9Mx6VLj1scgQa7E/JD7VdjcTJ+cBq6dT+UuRtFNrA0Bp4 vpshqVea2LRtTdadmLQ0PcF8lIyiRYQv1DgBfC5ng6JX9WOEwJUmOCKnhL2dHOtQ4j70 dwWvA08ccpTWQoYfexni8Ha9oW5S0iIlvVeRG22hjLgknRHEKxe9aVrDqGSWiauOXg8w tYxWVOV6EfPJ1d56mioqrk7hB0Gau8bgVYMgFfheaL+FWqjCb8Y+F7yNz3A5CNhHpo/S sjFQ==
Date: Thu, 20 Aug 2015 07:53:40 -0500
X-Spam-Level:
To: bug-Bio-SamTools@rt.cpan.org
Content-Transfer-Encoding: 7bit
X-GM-Message-State: ALoCoQk2Qh6VGxajkQhSeqm2Pauf8Gd0GJ2O4RaroW5HmBAvsBUlpbY4hya3Aq03bPKtIHSJppMndtuJ6dfj4ScSTHuBTO5p/TjZB+1QxpHQRIDxci2eZvhYBSNcNdrtbkn300Vx8plMPbbbbvd3iuMoHe0mkcpSD6Rqos5+CIEW/gxgLM9TUg8X5XTs6IaBKcIwD1lKnPzg
From: Sam Hokin <shokin@carnegiescience.edu>
RT-Message-ID: <rt-4.0.18-15774-1440075233-1178.101735-0-0@rt.cpan.org>
Content-Length: 312
Whoa, this is an old one. I think I wound up munging the files so they'd work. :) Thanks, though! On 08/20/2015 07:26 AM, Dan Bolser via RT wrote:
Show quoted text
> <URL: https://rt.cpan.org/Ticket/Display.html?id=101735 > > > Are both BAM files definitely sorted and indexed (with the same naming convention for the index)? >


This service runs on Request Tracker, is sponsored by The Perl Foundation, and maintained by Best Practical Solutions.

Please report any issues with rt.cpan.org to rt-cpan-admin@bestpractical.com.